ID: 915671982_915671994

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 915671982 915671994
Species Human (GRCh38) Human (GRCh38)
Location 1:157497286-157497308 1:157497322-157497344
Sequence CCCTCCACTATATCCTTAAAAAC TTCTCAGGGAGATGGATTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!