ID: 915682341_915682346

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 915682341 915682346
Species Human (GRCh38) Human (GRCh38)
Location 1:157593519-157593541 1:157593572-157593594
Sequence CCTCTTACTTGAGGCCTAGTTAT TGTATCTAATTGGCTGTATGAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 33, 3: 67, 4: 106} {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!