ID: 915724300_915724307

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 915724300 915724307
Species Human (GRCh38) Human (GRCh38)
Location 1:158006941-158006963 1:158006972-158006994
Sequence CCGCCTTGCCAGGGTGGATCCCA CAGTGTAAGCAGAGAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 180} {0: 1, 1: 0, 2: 3, 3: 48, 4: 674}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!