ID: 915725686_915725689

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 915725686 915725689
Species Human (GRCh38) Human (GRCh38)
Location 1:158015414-158015436 1:158015429-158015451
Sequence CCATTGGAGAGTTGGGAACCAAG GAACCAAGATGGAATGGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134} {0: 1, 1: 0, 2: 2, 3: 45, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!