ID: 915790667_915790668

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 915790667 915790668
Species Human (GRCh38) Human (GRCh38)
Location 1:158666835-158666857 1:158666848-158666870
Sequence CCAAACACTCTATTTTCTAGGAG TTTCTAGGAGAAGCATAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187} {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!