ID: 915815774_915815784

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 915815774 915815784
Species Human (GRCh38) Human (GRCh38)
Location 1:158963162-158963184 1:158963196-158963218
Sequence CCCCTCTGCCACTGCTGCTGCAG TGCTGCCTTCAGACTGGGGAAGG
Strand - +
Off-target summary {0: 3, 1: 15, 2: 101, 3: 229, 4: 740} {0: 1, 1: 8, 2: 33, 3: 99, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!