ID: 915831707_915831714

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 915831707 915831714
Species Human (GRCh38) Human (GRCh38)
Location 1:159137353-159137375 1:159137367-159137389
Sequence CCTATTAAAACCTACGTGCTGGG CGTGCTGGGGCTGGGCGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69} {0: 1, 1: 5, 2: 42, 3: 396, 4: 2548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!