ID: 915898548_915898551

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 915898548 915898551
Species Human (GRCh38) Human (GRCh38)
Location 1:159829787-159829809 1:159829808-159829830
Sequence CCTATAGCAGCTCAGATGCATGC GCAAAGAAGGATGAGGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98} {0: 1, 1: 0, 2: 4, 3: 55, 4: 644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!