ID: 915900023_915900026

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 915900023 915900026
Species Human (GRCh38) Human (GRCh38)
Location 1:159840196-159840218 1:159840216-159840238
Sequence CCATTTAAACTCTGTCTAACCAG CAGAGAGAAAATGAAGAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157} {0: 1, 1: 2, 2: 7, 3: 101, 4: 956}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!