ID: 915903456_915903460

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 915903456 915903460
Species Human (GRCh38) Human (GRCh38)
Location 1:159862333-159862355 1:159862351-159862373
Sequence CCCGGCTGCAGCAGGGCAAGGGT AGGGTGGGCAGCACCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 437} {0: 1, 1: 0, 2: 7, 3: 57, 4: 1169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!