ID: 915937237_915937247

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 915937237 915937247
Species Human (GRCh38) Human (GRCh38)
Location 1:160096692-160096714 1:160096735-160096757
Sequence CCCATGCCCAGCTGTGTGGCCTG CTAGGCCTCAGTTTCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 81, 4: 591} {0: 1, 1: 2, 2: 31, 3: 180, 4: 782}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!