ID: 915937763_915937780

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 915937763 915937780
Species Human (GRCh38) Human (GRCh38)
Location 1:160098929-160098951 1:160098960-160098982
Sequence CCCAGCCCCAGTTCCGGCCCCTC CGCCCCACCAGGACTACAGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 91, 4: 565} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!