ID: 915937764_915937780

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 915937764 915937780
Species Human (GRCh38) Human (GRCh38)
Location 1:160098930-160098952 1:160098960-160098982
Sequence CCAGCCCCAGTTCCGGCCCCTCC CGCCCCACCAGGACTACAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 109, 4: 966} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!