ID: 915946042_915946047

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 915946042 915946047
Species Human (GRCh38) Human (GRCh38)
Location 1:160152550-160152572 1:160152581-160152603
Sequence CCCTTGTTTCCACAGAATATAAT TCCCTGGACCTTTGCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 392} {0: 1, 1: 5, 2: 6, 3: 27, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!