ID: 916074604_916074614

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 916074604 916074614
Species Human (GRCh38) Human (GRCh38)
Location 1:161193239-161193261 1:161193280-161193302
Sequence CCAGTGCCTGGGCCTGGCAGGTG GGGGCCACGCCTGTGTAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 459} {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!