ID: 916118435_916118437

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 916118435 916118437
Species Human (GRCh38) Human (GRCh38)
Location 1:161507611-161507633 1:161507628-161507650
Sequence CCAGAGAGATCCTGGCTGTGGAG GTGGAGTCGCTTTCTGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 287} {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!