ID: 916128643_916128652

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 916128643 916128652
Species Human (GRCh38) Human (GRCh38)
Location 1:161592712-161592734 1:161592757-161592779
Sequence CCAACTATATGACCCAAGTGAGT GCTGTCTCATGTGGAAAATGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 1, 2: 8, 3: 158, 4: 1510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!