ID: 916156803_916156804

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 916156803 916156804
Species Human (GRCh38) Human (GRCh38)
Location 1:161858741-161858763 1:161858763-161858785
Sequence CCATACAGCTGAAAATGCAAAAG GCTCATGACTAGTTTTTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 294} {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!