ID: 916173040_916173042

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 916173040 916173042
Species Human (GRCh38) Human (GRCh38)
Location 1:162015595-162015617 1:162015611-162015633
Sequence CCTAGGAAAACAGAGGCACTTCC CACTTCCCAATATTGGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 290} {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!