ID: 916204099_916204108

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 916204099 916204108
Species Human (GRCh38) Human (GRCh38)
Location 1:162298451-162298473 1:162298482-162298504
Sequence CCTAGAACTCCCACCCACACCCA GAGGATCAGCAGAGGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 550} {0: 1, 1: 1, 2: 3, 3: 111, 4: 1142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!