ID: 916252744_916252749

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 916252744 916252749
Species Human (GRCh38) Human (GRCh38)
Location 1:162754615-162754637 1:162754632-162754654
Sequence CCTCTCAAGGCTGGACTCAGAAG CAGAAGAAGGGGATGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178} {0: 1, 1: 0, 2: 2, 3: 61, 4: 1345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!