ID: 916414331_916414338

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 916414331 916414338
Species Human (GRCh38) Human (GRCh38)
Location 1:164578581-164578603 1:164578612-164578634
Sequence CCCTCAAGGAGCTTCCAGGGGCC GGGCAGAATCAATGTGACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 258} {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!