ID: 916437074_916437085

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 916437074 916437085
Species Human (GRCh38) Human (GRCh38)
Location 1:164787344-164787366 1:164787375-164787397
Sequence CCACCCTCCCTGTAGATCTGCCC TCCCAACCTGCCCCCACCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 273} {0: 1, 1: 0, 2: 3, 3: 57, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!