ID: 916444257_916444266

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 916444257 916444266
Species Human (GRCh38) Human (GRCh38)
Location 1:164857308-164857330 1:164857352-164857374
Sequence CCAAACAGAGAGGCACATAGTGG CACAGGAGCCTCTAACCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141} {0: 1, 1: 0, 2: 5, 3: 91, 4: 1390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!