ID: 916490812_916490820

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 916490812 916490820
Species Human (GRCh38) Human (GRCh38)
Location 1:165300824-165300846 1:165300865-165300887
Sequence CCTGCCTGCTTCTCCTCATTCAT GAACCCAGGTATATTACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 63, 4: 632} {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!