|
Left Crispr |
Right Crispr |
| Crispr ID |
916533509 |
916533516 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:165680864-165680886
|
1:165680901-165680923
|
| Sequence |
CCCGAAACTGGGAACAGAAAGAG |
ACAGTTCCACATGGCTAGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} |
{0: 324, 1: 4567, 2: 7054, 3: 7797, 4: 6072} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|