ID: 916632214_916632216

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 916632214 916632216
Species Human (GRCh38) Human (GRCh38)
Location 1:166628556-166628578 1:166628590-166628612
Sequence CCAGCGTGAAGGAGTTCACAGAA TTTTGAAGACAGCACTGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 13, 4: 76} {0: 1, 1: 0, 2: 2, 3: 14, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!