ID: 916651830_916651838

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 916651830 916651838
Species Human (GRCh38) Human (GRCh38)
Location 1:166840155-166840177 1:166840190-166840212
Sequence CCCTCAAGATGCATCCGCACTCC TGCCCGCGCCCATAGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96} {0: 1, 1: 0, 2: 0, 3: 0, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!