ID: 916674654_916674659

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 916674654 916674659
Species Human (GRCh38) Human (GRCh38)
Location 1:167055170-167055192 1:167055198-167055220
Sequence CCCAGCCAGGGGAGCAGCAGCTA TTCTGGTAACACTCCATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 265} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!