ID: 916751708_916751715

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 916751708 916751715
Species Human (GRCh38) Human (GRCh38)
Location 1:167728922-167728944 1:167728973-167728995
Sequence CCTGATATTCTACTTTAGGATCT ATGCTGTTATCGGCCGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 181} {0: 1, 1: 0, 2: 8, 3: 87, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!