ID: 916787439_916787445

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 916787439 916787445
Species Human (GRCh38) Human (GRCh38)
Location 1:168096756-168096778 1:168096773-168096795
Sequence CCCCAGGTGACCATGAAGGCACC GGCACCGAGGACCACCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 191} {0: 1, 1: 0, 2: 4, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!