ID: 916985953_916985966

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 916985953 916985966
Species Human (GRCh38) Human (GRCh38)
Location 1:170191640-170191662 1:170191692-170191714
Sequence CCACAGGCTGGAATGGCTGTCAT TCCCCAGGCACTCTATCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 206} {0: 1, 1: 0, 2: 25, 3: 167, 4: 964}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!