ID: 917033486_917033490

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 917033486 917033490
Species Human (GRCh38) Human (GRCh38)
Location 1:170720911-170720933 1:170720958-170720980
Sequence CCCTTATATGCCAAGTAGTGTTC CTCACACCAATTCAGTGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 213} {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!