ID: 917076487_917076488

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 917076487 917076488
Species Human (GRCh38) Human (GRCh38)
Location 1:171211416-171211438 1:171211433-171211455
Sequence CCTTATTTCATCATTATCACTAC CACTACCCATTTAGTAGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 239} {0: 1, 1: 0, 2: 0, 3: 15, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!