ID: 917111799_917111816

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 917111799 917111816
Species Human (GRCh38) Human (GRCh38)
Location 1:171556358-171556380 1:171556400-171556422
Sequence CCCCCCACCCCTTGTGCTTCCTG CTGCTTTGGCTCACCCTCCGTGG
Strand - +
Off-target summary {0: 3, 1: 51, 2: 142, 3: 281, 4: 775} {0: 49, 1: 266, 2: 534, 3: 972, 4: 1120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!