ID: 917114484_917114488

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 917114484 917114488
Species Human (GRCh38) Human (GRCh38)
Location 1:171588731-171588753 1:171588758-171588780
Sequence CCCCACACAGCTCTGATAATGAG TTTCCTTTTAACTTTTTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210} {0: 1, 1: 2, 2: 25, 3: 266, 4: 2606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!