ID: 917262770_917262776

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 917262770 917262776
Species Human (GRCh38) Human (GRCh38)
Location 1:173187890-173187912 1:173187943-173187965
Sequence CCACAATTCAGTAATTCTTGCTT CTGAAAAAGAGGACCACTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 279} {0: 1, 1: 0, 2: 7, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!