ID: 917355388_917355393

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 917355388 917355393
Species Human (GRCh38) Human (GRCh38)
Location 1:174121777-174121799 1:174121819-174121841
Sequence CCTTTTTTTTCTGTGTGCGGGTG TGTGCATAAGCATGCACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 420} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!