ID: 917377299_917377304

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 917377299 917377304
Species Human (GRCh38) Human (GRCh38)
Location 1:174363223-174363245 1:174363254-174363276
Sequence CCAGCTTTGTTTCTTTTTGCTTA TTGGCTATTCAAGCTTTTCTGGG
Strand - +
Off-target summary {0: 2, 1: 22, 2: 107, 3: 302, 4: 1740} {0: 1, 1: 1, 2: 20, 3: 139, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!