ID: 917402812_917402817

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 917402812 917402817
Species Human (GRCh38) Human (GRCh38)
Location 1:174669807-174669829 1:174669849-174669871
Sequence CCAGGCCCTCTATTCTGTTTCTT TATGCCAATCCCATGCTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 133, 4: 995} {0: 1, 1: 11, 2: 85, 3: 202, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!