ID: 917411298_917411300

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 917411298 917411300
Species Human (GRCh38) Human (GRCh38)
Location 1:174762509-174762531 1:174762533-174762555
Sequence CCCTTTGTCTTCTAGGACATCTA TTGACAGTCCTTTGCATACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 239} {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!