ID: 917417260_917417262

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 917417260 917417262
Species Human (GRCh38) Human (GRCh38)
Location 1:174823488-174823510 1:174823520-174823542
Sequence CCGATTTACAGAAGAAAAGAAAA GAACCCTTGTTGCTTCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 25, 3: 265, 4: 2554} {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!