ID: 917456769_917456776

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 917456769 917456776
Species Human (GRCh38) Human (GRCh38)
Location 1:175192682-175192704 1:175192701-175192723
Sequence CCTGGTTGCTGCCCCGTCTGACA GACAGCGCCCCGGGCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 229, 4: 663} {0: 1, 1: 0, 2: 0, 3: 28, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!