ID: 917558730_917558733

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 917558730 917558733
Species Human (GRCh38) Human (GRCh38)
Location 1:176121557-176121579 1:176121597-176121619
Sequence CCAGGCTGGAGTGCAGTGACACA CTACTTTGACAGTTGCAACTTGG
Strand - +
Off-target summary {0: 1148, 1: 30404, 2: 94797, 3: 185119, 4: 212049} {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!