ID: 917594431_917594433

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 917594431 917594433
Species Human (GRCh38) Human (GRCh38)
Location 1:176514694-176514716 1:176514735-176514757
Sequence CCATAGCATTCTTCATGGGATGA TTGACTTTGAATCAAATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116} {0: 1, 1: 0, 2: 2, 3: 35, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!