ID: 917600934_917600944

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 917600934 917600944
Species Human (GRCh38) Human (GRCh38)
Location 1:176573033-176573055 1:176573071-176573093
Sequence CCAAAGAACCTTGAGAGAGATGG GTGCTGAGGCATCCTGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 214} {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!