ID: 917743160_917743162

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 917743160 917743162
Species Human (GRCh38) Human (GRCh38)
Location 1:177981399-177981421 1:177981424-177981446
Sequence CCGGAACTTATGCTTGAACTACT GAAAGAAGGATGTTTCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 0, 3: 40, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!