ID: 917756754_917756755

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 917756754 917756755
Species Human (GRCh38) Human (GRCh38)
Location 1:178109080-178109102 1:178109101-178109123
Sequence CCACAAGTTGTATTCATCTGGGA GACATAGCTTTATTTACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 177} {0: 1, 1: 0, 2: 0, 3: 19, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!