ID: 917763710_917763717

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 917763710 917763717
Species Human (GRCh38) Human (GRCh38)
Location 1:178194427-178194449 1:178194460-178194482
Sequence CCAACACATCCACCAACTATGCC CTGGAAGTACAGGAGAAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137} {0: 1, 1: 0, 2: 1, 3: 33, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!