ID: 917777000_917777002

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 917777000 917777002
Species Human (GRCh38) Human (GRCh38)
Location 1:178348654-178348676 1:178348687-178348709
Sequence CCTATTATAAGCGCTCCAGTTTG AAACAAAAACAAAAAACTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 21, 2: 175, 3: 1715, 4: 11422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!